Jim R Posted February 15, 2005 Report Share Posted February 15, 2005 I would just, personally, hereby like to volunteer to be the spokesman for jazz - and I will do it without renumeration (well, maybe I'll pass the hat from time to time). But I will do it and I will do it gladly. Check this board for future pronouncements (and please let me know if I spelled "hereby" correctly). "Hereby", yes. "Remuneration", no. Give me a President who can spell. Quote Link to comment Share on other sites More sharing options...
AllenLowe Posted February 16, 2005 Report Share Posted February 16, 2005 "Give me a President who can spell." GOD DOES NOT HAVE SPELL CHECK Quote Link to comment Share on other sites More sharing options...
couw Posted February 16, 2005 Report Share Posted February 16, 2005 just what the world needs, another president who thinks he's god. Quote Link to comment Share on other sites More sharing options...
Chuck Nessa Posted February 16, 2005 Report Share Posted February 16, 2005 just what the world needs, another president who thinks he's god. Quote Link to comment Share on other sites More sharing options...
catesta Posted February 16, 2005 Report Share Posted February 16, 2005 just what the world needs, another president who thinks he's god. Don't sweat it JC, at least he posts on this board. Quote Link to comment Share on other sites More sharing options...
l p Posted February 16, 2005 Report Share Posted February 16, 2005 If you visit JR with any regularity, you will probably have noted that there is a particularly pesky fool who trolls there at the mere mention of a certain pedestrian composer (who also plays a soul-less horn). A regular poster, who makes interesting observations and truly contributes to that BBS, is the latest victim of this troll's childish personal attacks. I just read the thread to which I have placed a link here (at the bottom) and it is remarkable to see that this troll--whose purpose is, clearly, not to engage in reasoned discussion, but rather to confront with arrogant suppositions--gets encouragement from a couple of misguided posters (including "Rainy Day") who have fallen for his absurd injection of racism, and little or no support from others. Since I have also been a victim of this troll's schoolyard illogic, I hope that Jared (Sonic1, who also is a member of "O") reads this post and sees that there are some of us who think his response #224 is right on the money. Thank you, Jared, perhaps the relative silence of your fellow posters--not to mention the board's administrator, is even more grievous than the unfair assessment (and support thereof) this troll regularly pulls from his little bag of shallow babble. That any intelligent person can take this infantile poster seriously, or simply sit back and nod or shake his/her head, is beyond my understanding. It is when reading this kind of venom that I find it difficult not to post at JC, but I have vowed to never do that again. Check out this link and let me hear what you think. gosh Chris, thank you for the extremely valuable, and much too short, info. >>It is when reading this kind of venom that I find it difficult not to post at JC, but I have vowed to never do that again. >>> please let me know if there is anything that i can do to help you make up your mind to stop posting here as well. then where are you going to post? you going to write emails to yourself, and reply to them? Quote Link to comment Share on other sites More sharing options...
maren Posted February 16, 2005 Report Share Posted February 16, 2005 anything that i can do to help you make up your mind to stop posting here as well I certainly hope not! Consider yourself in good company, Christiern -- from what I've read, "l p" seems to have it in for Chuck Nessa, Jim Sangrey, Catesta, Soulstation 1... and now probably me as well! Quote Link to comment Share on other sites More sharing options...
John B Posted February 16, 2005 Report Share Posted February 16, 2005 (edited) please let me know if there is anything that i can do to help you make up your mind to stop posting here as well. and you are the troll who infests Organissimo. Please let us all know if there is anything that we can do to help you make up your mind to stop posting here as well. Seriously, have you ever added anything positive to any discussion here? edit - I just saw your racist post in the jewish jazz musicians thread. Please, just delete that post and leave. This is a nice board. We don't need that racist bs here. Edited February 16, 2005 by John B Quote Link to comment Share on other sites More sharing options...
7/4 Posted February 16, 2005 Report Share Posted February 16, 2005 (edited) hmm.... edited for smiley. Edited February 16, 2005 by 7/4 Quote Link to comment Share on other sites More sharing options...
rockefeller center Posted February 16, 2005 Report Share Posted February 16, 2005 I must say that the Christiern gossip threads are among my favorites. Keep them coming! Quote Link to comment Share on other sites More sharing options...
l p Posted February 16, 2005 Report Share Posted February 16, 2005 please let me know if there is anything that i can do to help you make up your mind to stop posting here as well. edit - I just saw your racist post in the jewish jazz musicians thread. Please, just delete that post and leave. This is a nice board. We don't need that racist bs here. it's not a racist post if i'm jewish. and if you read jazz history/biography books, you would see that i'm right. or is a book a little too much commitment for you? Quote Link to comment Share on other sites More sharing options...
John B Posted February 16, 2005 Report Share Posted February 16, 2005 it's not a racist post if i'm jewish. and if you read jazz history/biography books, you would see that i'm right. or is a book a little too much commitment for you? Yes, it is too much commitment, as I am functionally illiterate. Nice catch. Your ethnicity does not excuse the content of your comments. A racist statement is racist no matter who utters it. Quote Link to comment Share on other sites More sharing options...
couw Posted February 16, 2005 Report Share Posted February 16, 2005 hmm, RNA. what does it encode? GUUCAGAGCCAGCGCGCCGCGGCUUAUUAACGCGAGACGCGCGAGCGACGGCAGAGCGACCCCCAGUCGAUGCCGGCCUGCG Quote Link to comment Share on other sites More sharing options...
l p Posted February 16, 2005 Report Share Posted February 16, 2005 Your ethnicity does not excuse the content of your comments. A racist statement is racist no matter who utters it. Quote Link to comment Share on other sites More sharing options...
maren Posted February 16, 2005 Report Share Posted February 16, 2005 hmm, RNA. what does it encode? GUUCAGAGCCAGCGCGCCGCGGCUUAUUAACGCGAGACGCGCGAGCGACGGCAGAGCGACCCCCAGUCGAUGCCGGCCUGCG Is Rockefeller Center asking us to STOP ? Quote Link to comment Share on other sites More sharing options...
couw Posted February 16, 2005 Report Share Posted February 16, 2005 hmm, RNA. what does it encode? GUUCAGAGCCAGCGCGCCGCGGCUUAUUAACGCGAGACGCGCGAGCGACGGCAGAGCGACCCCCAGUCGAUGCCGGCCUGCG Is Rockefeller Center asking us to STOP ? doesn't that depend on whether it's tRNA or mRNA? It's been too long, I forgot this stuff. Quote Link to comment Share on other sites More sharing options...
7/4 Posted February 16, 2005 Report Share Posted February 16, 2005 hmm, RNA. what does it encode? GUUCAGAGCCAGCGCGCCGCGGCUUAUUAACGCGAGACGCGCGAGCGACGGCAGAGCGACCCCCAGUCGAUGCCGGCCUGCG Looks like an open tuning for an Organissimo. Quote Link to comment Share on other sites More sharing options...
SGUD missile Posted February 16, 2005 Report Share Posted February 16, 2005 hmm, RNA. what does it encode? GUUCAGAGCCAGCGCGCCGCGGCUUAUUAACGCGAGACGCGCGAGCGACGGCAGAGCGACCCCCAGUCGAUGCCGGCCUGCG Looks like an open tuning for an Organissimo. please show me where the U string is placed Quote Link to comment Share on other sites More sharing options...
catesta Posted February 16, 2005 Report Share Posted February 16, 2005 anything that i can do to help you make up your mind to stop posting here as well I certainly hope not! Consider yourself in good company, Christiern -- from what I've read, "l p" seems to have it in for Chuck Nessa, Jim Sangrey, Catesta, Soulstation 1... and now probably me as well! Thanks for the compliment, maren. Quote Link to comment Share on other sites More sharing options...
catesta Posted February 16, 2005 Report Share Posted February 16, 2005 Your ethnicity does not excuse the content of your comments. A racist statement is racist no matter who utters it. i disagree. Quote Link to comment Share on other sites More sharing options...
Use3D Posted February 16, 2005 Report Share Posted February 16, 2005 Why Quote Link to comment Share on other sites More sharing options...
JSngry Posted February 16, 2005 Report Share Posted February 16, 2005 hmm, RNA. what does it encode? GUUCAGAGCCAGCGCGCCGCGGCUUAUUAACGCGAGACGCGCGAGCGACGGCAGAGCGACCCCCAGUCGAUGCCGGCCUGCG Almost looks like guacamole to me. Quote Link to comment Share on other sites More sharing options...
Jazzmoose Posted February 16, 2005 Report Share Posted February 16, 2005 So the C stands for Cilantro? Quote Link to comment Share on other sites More sharing options...
7/4 Posted February 16, 2005 Report Share Posted February 16, 2005 hmm, RNA. what does it encode? GUUCAGAGCCAGCGCGCCGCGGCUUAUUAACGCGAGACGCGCGAGCGACGGCAGAGCGACCCCCAGUCGAUGCCGGCCUGCG Looks like an open tuning for an Organissimo. please show me where the U string is placed inbetween. Quote Link to comment Share on other sites More sharing options...
JSngry Posted February 16, 2005 Report Share Posted February 16, 2005 So the C stands for Cilantro? C is for Cookie. That's good enough for me. Quote Link to comment Share on other sites More sharing options...
_forumlogo.png.a607ef20a6e0c299ab2aa6443aa1f32e.png)
Recommended Posts
Join the conversation
You can post now and register later. If you have an account, sign in now to post with your account.